View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_2D_low_107 (Length: 293)
Name: NF1623_2D_low_107
Description: NF1623_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_2D_low_107 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 95 - 274
Target Start/End: Complemental strand, 42210668 - 42210489
Alignment:
| Q |
95 |
aaataaagcattagtatttatgagtannnnnnnagggagtagttaatttttcatacattatccaaccctttacctcgcaataaattacttttacgtcttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42210668 |
aaataaagcattagtatttatgagtatttttttagggagtagttaatttttcatacattatccaaccctttacctcacaataaattacttttacgtcttc |
42210569 |
T |
 |
| Q |
195 |
ctnnnnnnnntattacttcttctctttgacactcaaattggtcaactacattacattatacacataacttgagacgcatg |
274 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42210568 |
ctataaaaaatattacttcttctctttgacactcaaattgatcaactacattacattatacacataacttgagacgcatg |
42210489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University