View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_2D_low_114 (Length: 283)
Name: NF1623_2D_low_114
Description: NF1623_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_2D_low_114 |
 |  |
|
| [»] scaffold0187 (4 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 265
Target Start/End: Complemental strand, 37855096 - 37854829
Alignment:
| Q |
11 |
gttcggtcaattgtgtccgcctctcttacaacagggcagatatcttatgtagtacaacatgtgtttaaatactacggtccaatttataagat-------- |
102 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37855096 |
gttcggtcaattgtgtctgcctctcttacaacagggcagatatcttatgtagtacaacatgtttttaaatactacggtccaatttataagattatccttg |
37854997 |
T |
 |
| Q |
103 |
-----cccactcgaataacctttccacttatcagtaagctacgagacataacctaaattcttcaaaattcaaacaagatcacatggaacagtgaattatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37854996 |
actaacccactcgaataacctttccacttatcagtaagctacgagacataaccaaaattcttcaaaattcaaacaagatcacatggaacagtgaattatg |
37854897 |
T |
 |
| Q |
198 |
attcaacttttagaaaaggtacgttttatgtggcccgatggtttcttgcttgacttgatagtcatgtg |
265 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37854896 |
attcaacttttagaaaaggtacattttatgtggcccgatggtttcttgcttgacttgatagtcatgtg |
37854829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 168 - 241
Target Start/End: Complemental strand, 37911325 - 37911253
Alignment:
| Q |
168 |
aaacaagatcacatggaacagtgaattatgattcaacttttagaaaaggtacgttttatgtggcccgatggttt |
241 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||| ||| |||||||| | |||| ||||||||||| |||| |
|
|
| T |
37911325 |
aaacaagatcacatggaactgtaaattatgattcaac-tttggaaaaggtgcattttctgtggcccgatagttt |
37911253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 181 - 256
Target Start/End: Complemental strand, 37881368 - 37881293
Alignment:
| Q |
181 |
tggaacagtgaattatgattcaacttttagaaaaggtacgttttatgtggcccgatggtttcttgcttgacttgat |
256 |
Q |
| |
|
||||||| | |||||| ||||||||||| || |||||| |||| ||||| ||||||||||||| || |||||||| |
|
|
| T |
37881368 |
tggaacattaaattatcattcaacttttggactaggtacattttttgtggtccgatggtttctttctagacttgat |
37881293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 4)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 168 - 256
Target Start/End: Original strand, 7055 - 7148
Alignment:
| Q |
168 |
aaacaagatcacatggaacagtgaattatgattcaacttttagaaaaggtacgttt----tatgtggcccgatggtttc-ttgcttgacttgat |
256 |
Q |
| |
|
||||||||||||||||||| || ||||||||| |||||||| ||||||||| ||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
7055 |
aaacaagatcacatggaactgtaaattatgatacaacttttgcaaaaggtacattttatatatgtggcccgattgtttctttgcttgacttgat |
7148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 168 - 256
Target Start/End: Original strand, 17383 - 17476
Alignment:
| Q |
168 |
aaacaagatcacatggaacagtgaattatgattcaacttttagaaaaggtacgttt----tatgtggcccgatggtttc-ttgcttgacttgat |
256 |
Q |
| |
|
||||||||||||||||||| || ||||||||| |||||||| ||||||||| ||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
17383 |
aaacaagatcacatggaactgtaaattatgatacaacttttgcaaaaggtacattttatatatgtggcccgattgtttctttgcttgacttgat |
17476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 168 - 241
Target Start/End: Original strand, 27752 - 27824
Alignment:
| Q |
168 |
aaacaagatcacatggaacagtgaattatgattcaacttttagaaaaggtacgttttatgtggcccgatggttt |
241 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||| ||| |||||||| | |||| ||||||||||| |||| |
|
|
| T |
27752 |
aaacaagatcacatggaactgtaaattatgattcaac-tttggaaaaggtgcattttctgtggcccgatagttt |
27824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 208
Target Start/End: Original strand, 290 - 330
Alignment:
| Q |
168 |
aaacaagatcacatggaacagtgaattatgattcaactttt |
208 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
290 |
aaacaagttcacatggaacagtaaattatgattcaactttt |
330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 70 - 100
Target Start/End: Original strand, 10842656 - 10842686
Alignment:
| Q |
70 |
tgtgtttaaatactacggtccaatttataag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10842656 |
tgtgtttaaatactacggtccaatttataag |
10842686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University