View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_2D_low_118 (Length: 270)
Name: NF1623_2D_low_118
Description: NF1623_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_2D_low_118 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 4 - 251
Target Start/End: Complemental strand, 45311406 - 45311159
Alignment:
| Q |
4 |
tctctttctcatcatgttcttcatcttgtttctcttcctttttctccacaatcaccatatcaacaacactcacttctagtttcttctcatcatttgttgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45311406 |
tctctttctcatcatgttcttcatcttgtttctcttcctttttctccacaatcaccatatcaacaacactcacttctagtttcttctcatcatttgttgt |
45311307 |
T |
 |
| Q |
104 |
tttacttggaactactacgttttcaatttctttgtcgacaatgtctcctttatgttctggtagcttctcatcaattacgggtttgctgtttctgtacatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45311306 |
tttacttggaactactacgttttcaatttctttgtcgacaatgtctcctttatgttctggtagcttctcatcaattacgggtttgctgtttctgtacatt |
45311207 |
T |
 |
| Q |
204 |
gcatagagtgtgatctgaactattccaaatgttaaccccacaacgttc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45311206 |
gcatagagtgtgatctgaactattccaaatgttaaccccacaacgttc |
45311159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University