View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_2D_low_138 (Length: 228)
Name: NF1623_2D_low_138
Description: NF1623_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_2D_low_138 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 54 - 201
Target Start/End: Complemental strand, 42025245 - 42025083
Alignment:
| Q |
54 |
tatttttattcttttgcagttgccatttttacagtttaatgctatattttatcaattcta--------------ttaagtggttgatgaagattaataaa |
139 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42025245 |
tatttttattcttttgtagttgccatttttacagtttaaagctatattttatcaattctaccttatcaattctattaagtggttgatgaagattaataaa |
42025146 |
T |
 |
| Q |
140 |
attgaaaagtttcagtacccttgtcgctcataatagcaagccatattaaat-aaatcttaggt |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
42025145 |
attgaaaagttttagtacccttgtcgctcataatagcaagccgtattaaataaaatcttaggt |
42025083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 57
Target Start/End: Complemental strand, 42025629 - 42025591
Alignment:
| Q |
19 |
gtgatagtgcaagtgtatgtgtgcatatatactagtatt |
57 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42025629 |
gtgatagtgcaagtatatgtgtgcatatatactagtatt |
42025591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 57
Target Start/End: Complemental strand, 1252835 - 1252797
Alignment:
| Q |
19 |
gtgatagtgcaagtgtatgtgtgcatatatactagtatt |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1252835 |
gtgatagtgcaagtgtatgtgtgcatatatactagtatt |
1252797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University