View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_2D_low_142 (Length: 224)
Name: NF1623_2D_low_142
Description: NF1623_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_2D_low_142 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 4890759 - 4890545
Alignment:
| Q |
1 |
atcattaatgatgtagcagtgatgtggtacaacaactcttcaacctccaccgctccacgtagctcctccgacacccaatcctcgatcttcgtctctcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4890759 |
atcattaatgatgtagcagtgatgtggtacaacaactcttcaacctccaccgctccacatagctcctccgacacccaatcctcgatcttcgtctctcaaa |
4890660 |
T |
 |
| Q |
101 |
gaagcttcgagatctcatggttgttgagcttgagaagcttgattttgcaaaggcagcaccgtttcaattcaagatcctcaactcagctgtgccacaaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4890659 |
gaagcttcgagatctcatggttgttgagcttgagaagcttgattttgcaaaggcagcaccgtttcaattcaagatcctcaactcagctgtgccacaaatt |
4890560 |
T |
 |
| Q |
201 |
attaatgatgatgtc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4890559 |
attaatgatgatgtc |
4890545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 79 - 191
Target Start/End: Original strand, 50921339 - 50921450
Alignment:
| Q |
79 |
tcctcgatcttcgtctctcaaagaagcttcgagatctcatggttgttgagcttgagaagcttgattttgcaaaggcagcaccgtttcaattcaagatcct |
178 |
Q |
| |
|
|||||||||||| ||||| ||||||||| |||||| |||||||||||||| | ||||| ||||||| |||||| ||||| | |||| || ||||||| |
|
|
| T |
50921339 |
tcctcgatcttcttctctggaagaagctttgagatcccatggttgttgagcctcagaagtttgatttcacaaaggtagcacag-ttcatgtcgagatcct |
50921437 |
T |
 |
| Q |
179 |
caactcagctgtg |
191 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
50921438 |
caactcagttgtg |
50921450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University