View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_2D_low_148 (Length: 213)
Name: NF1623_2D_low_148
Description: NF1623_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_2D_low_148 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 36061092 - 36061286
Alignment:
| Q |
1 |
gtcggtttgacaaaaacattgaaaaacaagcagaagtaacnnnnnnntagtaacgatctctcaaaatcatatccattgattagaaggcaaacccttatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36061092 |
gtcggtttgacaaaaacattgaaaaacaagcagaagtaacaaaaaaatagtaacgatctctcaaaatcatatccattgattagaaggcaaacccttatct |
36061191 |
T |
 |
| Q |
101 |
tttaccatacaaatatcacagtacaaattcaaatagtaacaaacaatcatacaactaaactacaaacagaaggcacaaacaagcaatcacattca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36061192 |
tttaccatacaaatatcacagtacaaattcaaatagtaacaaacaatcatacaactaaactacaaacagaaggcacaaacaagcaatcacattca |
36061286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University