View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_2D_low_65 (Length: 383)
Name: NF1623_2D_low_65
Description: NF1623_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_2D_low_65 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 18721502 - 18721296
Alignment:
| Q |
18 |
gttacttaccaggatcaagtgaaagttgagaaagattgtattcagatgaaggagaagtgttgagtttgcatggaagtttgtgcaaatgggttttgagatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18721502 |
gttacttaccaggatcaagtgaaagttgagaaagattgtattcagatgaaggagaagtattgagtttgcatggaagtttgtgcaaatgggttttgagatt |
18721403 |
T |
|
| Q |
118 |
ttgagggaaagatggaatgaaaggtagttgttgaagtgaaggtaaaggaagaagagcagggtaatatctttgatacttgttttggtagtagttgttgtag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18721402 |
ttgagggaaagatggaatgaaaggtagttgttgaagtgaaggtaaaggaagaagagcagggtaatatctttgatacttgttttggtagtagttgttgtag |
18721303 |
T |
|
| Q |
218 |
aaaccaa |
224 |
Q |
| |
|
||||||| |
|
|
| T |
18721302 |
aaaccaa |
18721296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 291 - 364
Target Start/End: Complemental strand, 18721235 - 18721161
Alignment:
| Q |
291 |
agtgattatagtaatgatgatgttgatgagagtttgttccat-ttttgtgatgaaagtggttgttttgttttggt |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18721235 |
agtgattatagtaatgatgatgttgatgagagtttgttccattttttgtgatgaaagtggttgttttgttttggt |
18721161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University