View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_2D_low_76 (Length: 364)
Name: NF1623_2D_low_76
Description: NF1623_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_2D_low_76 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 1 - 346
Target Start/End: Complemental strand, 28829804 - 28829459
Alignment:
| Q |
1 |
aacggcaaggtaccagagataggatcagaccattttttcttcatcatatcatagagtcccatacgagtggtggaatagagacactgccggagaacggtgg |
100 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28829804 |
aacggcaaagtaccggagataggatcagaccattttttcttcatcatatcatagagtcccatacgagtggtggaatagagacactgccggagaacggtgg |
28829705 |
T |
 |
| Q |
101 |
cagagacaccggagaaaagtgctgctacaccttcttgctggactagcttaacaccaacggcgatcggcccaacacggggcggttgggccgtcaccgccgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28829704 |
cagagacaccggagaaaagtgctgctacaccttcttgttggactagcttaacaccaacggcgatcggcccaacacggggcggttgggccgtcaccgctgg |
28829605 |
T |
 |
| Q |
201 |
tgaccgatgaaccgaaccgggttggaaagctaatgctggtcggatattggttgtaggagcattctctccttgaagctgcattcgaaccttgatgagatca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28829604 |
tgaccgatgaaccgaaccgggttggaaagctaatgctggtcggatattggttgtaggagcattctctccttgaagctgcattcgaaccttgatgagatca |
28829505 |
T |
 |
| Q |
301 |
agagggtgtgttgaacaccctgcaatgatggaagctatgcctcctt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28829504 |
agagggtgtgttgaacaccctgcaatgatggaagctatgcctcctt |
28829459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University