View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1623_2D_low_95 (Length: 312)
Name: NF1623_2D_low_95
Description: NF1623_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1623_2D_low_95 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 60 - 287
Target Start/End: Original strand, 12067573 - 12067793
Alignment:
| Q |
60 |
cttgttccacattttctctttacctcgttagtgaatggaccacagataaagaagtactgtcagattcactagccactta-ttttcccatcaatgaatttt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12067573 |
cttgttccacattttctctttacctcgttagtgaatggaccacagataaagaagtactgtcagattcactagccacttatttttcccatcaatga----- |
12067667 |
T |
 |
| Q |
159 |
ccttcctttttcatttcactgcatgaat---aaatacacnnnnnnngaggaataattcctatatcactcaatcagtagtactagctactagaacagttcc |
255 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12067668 |
------tttttcatttcactgcatgaatgaataatacactttttttgaggaataattccgatatcacttaatcagtagtactagctactagaacagttcc |
12067761 |
T |
 |
| Q |
256 |
acaaatataaccagtaatagctccatgtgaac |
287 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
12067762 |
acaaatatagccagtaatagctccatgtgaac |
12067793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University