View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1624-INSERTION-3 (Length: 194)
Name: NF1624-INSERTION-3
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1624-INSERTION-3 |
 | |
|
| [»] scaffold1819 (1 HSPs) |
| | |
|
| [»] scaffold1104 (2 HSPs) |
| | |
|
| [»] scaffold0743 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1819 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: scaffold1819
Description:
Target: scaffold1819; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 10 - 165
Target Start/End: Complemental strand, 1332 - 1177
Alignment:
| Q |
10 |
aaatcaccggaagcttttggtactgacaacaagttttcagctgcttctattgaatcattacaaattatagtaatcctcttcatcacggtggctcttgtta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
1332 |
aaatcaccggaagcttttggtactgacaacaagttttcagctgcttctattgaatcattacaaattatagtaaccctcttcatcatggtggctcttgtta |
1233 |
T |
|
| Q |
110 |
tgagatattttgcaaatatcacttcttgcatacaaatttcagactattttggtttt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1232 |
tgagatattttgcaaatatcacttcttgcatacaaacttcagactattttggtttt |
1177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1104 (Bit Score: 144; Significance: 6e-76; HSPs: 2)
Name: scaffold1104
Description:
Target: scaffold1104; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 10 - 165
Target Start/End: Complemental strand, 2854 - 2699
Alignment:
| Q |
10 |
aaatcaccggaagcttttggtactgacaacaagttttcagctgcttctattgaatcattacaaattatagtaatcctcttcatcacggtggctcttgtta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
2854 |
aaatcaccggaagcttttggtactgacaacaagttttcagctgcttctattgaatcattacaaattatagtaaccctcttcatcatggtggctcttgtta |
2755 |
T |
|
| Q |
110 |
tgagatattttgcaaatatcacttcttgcatacaaatttcagactattttggtttt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2754 |
tgagatattttgcaaatatcacttcttgcatacaaacttcagactattttggtttt |
2699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1104; HSP #2
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 157 - 194
Target Start/End: Original strand, 657 - 694
Alignment:
| Q |
157 |
tttggttttgatgtttttatgttggtggtggaatttta |
194 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
657 |
tttggttttgatgtttttgtgttggtggtggagtttta |
694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0743 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: scaffold0743
Description:
Target: scaffold0743; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 20 - 136
Target Start/End: Original strand, 3985 - 4101
Alignment:
| Q |
20 |
aagcttttggtactgacaacaagttttcagctgcttctattgaatcattacaaattatagtaatcctcttcatcacggtggctcttgttatgagatattt |
119 |
Q |
| |
|
||||| |||||||||| |||| |||| || | ||||| || ||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
3985 |
aagctcttggtactgataacaggtttgcaccaacttctgttaaatcattgcaaattatagtaatcgtcttcatcatggtggctcttgttatgagatattt |
4084 |
T |
|
| Q |
120 |
tgcaaatatcacttctt |
136 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
4085 |
tgcaaattgcacttctt |
4101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University