View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_high_31 (Length: 372)
Name: NF16240_high_31
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 4388210 - 4387972
Alignment:
| Q |
18 |
actaggagcccccttcccctaggaaccggaagcttaacacacnnnnnnnnnttaaaattcttccgcccaccaaacacttctttgtgttttatgggtgcct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4388210 |
actaggagcccccttcccctaggaaccggaagcttaacaca--aaaaaaaattaaaattcttccgcccaccaaacacttctttgtgtgttatgggtgcct |
4388113 |
T |
 |
| Q |
118 |
cttttgttgatcctatcatctcatcaatgattgtgttgatttgtgtcgctctgccttcctttgtgactccaatcaaacaatttgttgaatcatggagaaa |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4388112 |
cttt-gttgatcctatcatctcatcaatgattgtgttgatttgtgtcgctctgccttcctttgtgactccaatcaaacaatttgtttaatcatggagaaa |
4388014 |
T |
 |
| Q |
218 |
gcaaaacatagtaagccgaggaacaagttctttacagaagca |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4388013 |
gcaaaacatagtaagccgaggaacaagttctttacagaagca |
4387972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University