View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_high_45 (Length: 323)
Name: NF16240_high_45
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_high_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 20 - 318
Target Start/End: Complemental strand, 5829100 - 5828802
Alignment:
| Q |
20 |
tcttgttggtggcgtttgtgtaagaatcatatgaagggttttgcttcagggtgtttttccacgaatttcatgagtttgcttatgggttgtaaatttagaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5829100 |
tcttgttggtggcgtttgtgtaagaatcatatgaagggttttgcttcagggtgttcttccacgaatttcatgagtttgcttatgggttgtaaatttagaa |
5829001 |
T |
|
| Q |
120 |
gatttgtgaagaactctattaaggtgtattttttggataatttggtgagtcaagttattgttgataatgtgtttgtgaaaagtctttattgacgatgtat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5829000 |
gatttgtgaagaactctattaaggtgtattttttggataatttggtgagtcaagttattgttgataatgtgtttgtgaaaagtctttattgatgatgtat |
5828901 |
T |
|
| Q |
220 |
ttgaattttttggttgctcctctttattagttcctctctctattagacggttggttcttctctttggttattgtgtcttcttttattgttcttctctct |
318 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5828900 |
ttgaatttttttgttgctcctctttattagttcctctctctattagacagttggttcttctctttggttattgtgtcttcttttattgttcttctctct |
5828802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University