View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_high_74 (Length: 228)
Name: NF16240_high_74
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_high_74 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 16 - 173
Target Start/End: Original strand, 23034369 - 23034525
Alignment:
| Q |
16 |
atgaaggaacatgaaagtgagagtgcagccgaaggttcagaatctagtttggagagactgttgtggtggttgttggttatgtgcaaacggttgtatggaa |
115 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
23034369 |
atgaagcaacatgaaagtgagagtgcaaccgaaggttcagaatctagtttggagagactgttgtggtggttgttggttatgtgccaacggttgt-tggaa |
23034467 |
T |
|
| Q |
116 |
aacatgtggctttatccagatcccgaaagattgaaatgtcacgtggatgctagatttc |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
23034468 |
aacatgtggctttatccagatcccgaaagattgaaatgtaacatggatgctagatttc |
23034525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University