View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16240_high_75 (Length: 225)

Name: NF16240_high_75
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16240_high_75
NF16240_high_75
[»] chr4 (1 HSPs)
chr4 (1-169)||(32810578-32810746)


Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 32810578 - 32810746
Alignment:
1 tgtagaacaagaacatacacggagaatagctatagcggcagtttaatcagcagaggtatgccatctctaaccagtaactactgaccaattttgattgcat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32810578 tgtagaacaagaacatacacggagaatagctatagcggcagtttaatcagcagaggtatgccatctctaaccagtaactactgaccaattttgattgcat 32810677  T
101 acacgcaatatttcccccactttcagaacaatggaactnnnnnnntaggtcagttttgatttcttattc 169  Q
    ||||||||||||||||||||||||||||||||||||||       ||||||||||||||||| ||||||    
32810678 acacgcaatatttcccccactttcagaacaatggaactaaaaaaataggtcagttttgatttattattc 32810746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University