View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_high_82 (Length: 219)
Name: NF16240_high_82
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_high_82 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 21 - 204
Target Start/End: Complemental strand, 6967434 - 6967250
Alignment:
| Q |
21 |
cagaaacaggttggacttttgaccacatgcaaaagacaacatagccacagttgcttgcttgtcacactacttgtattgtcatgtaatgtggtgaccatga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6967434 |
cagaaacaggttggacttttgaccacatgcaaaagacaacatagccacagttgcttgcttgtcacactacttgtattgtcatgtaatgtggtgaccatga |
6967335 |
T |
|
| Q |
121 |
gtttagttaagtttgtagaattcatttaaactgaattagaacaaattaatgactattt-cataaattatagtgcccaaatctgtg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6967334 |
gtttagttaagtttgtagaattcatttaaactgatttagaacaaattaatgactatttccataaattatagtgcccaaatctgtg |
6967250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University