View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_high_86 (Length: 212)
Name: NF16240_high_86
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_high_86 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 3438242 - 3438421
Alignment:
| Q |
18 |
gaggatcatgtcatagactgggatgatatcattgctcaagttttaaggtttgagactttagttatatgtgcttaatcatgtgttatgtagcaccgacact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3438242 |
gaggatcatgtcatagactgggatgatatcattgctcaagttttaaggtttgagactttagttatatgtgattaatcatgtgttatgtagcaccgacact |
3438341 |
T |
|
| Q |
118 |
tcatataaggcctgttccgatacatattgacattgttatattcatttacttattacatgtgtctatgtgttagttgtatc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438342 |
tcatataaggcctgttccgatacatattgacattgttatattcatttacttattacatgtgtctatgtgttagttgtatc |
3438421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University