View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_low_44 (Length: 334)
Name: NF16240_low_44
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_low_44 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 193 - 320
Target Start/End: Original strand, 5997859 - 5997986
Alignment:
| Q |
193 |
aaatttggtattctctgtcttttcttgtcgatggttgcccttagtgttacggtgttccagaactgaagaggcacattggactcactgaagaaaattcttt |
292 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5997859 |
aaatttggtattctctgtcttttctcgtcgatggttgcccttagtgttacggtgttccagaactgaaggggcacattggactcactgaagaaaattcttt |
5997958 |
T |
|
| Q |
293 |
ccttgtttatggccccccttagtattat |
320 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
5997959 |
ccttgtttatggccccccttagtgttat |
5997986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University