View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_low_48 (Length: 306)
Name: NF16240_low_48
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_low_48 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 306
Target Start/End: Complemental strand, 43268310 - 43268011
Alignment:
| Q |
11 |
caaaggaacatttatatctatctatatacgaatgaattataaaatgttggaatataattggtaattgatacttaaaatgatgnnnnnnnt----ggatac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43268310 |
caaaggaacatttatatctatctatataggaatgaattataaaatgttggaatataattggtaattgatacttaaaatgatggaaaaaaaaaaaggatac |
43268211 |
T |
 |
| Q |
107 |
ttacagagctaattccggctgcnnnnnnnggaataggcccgggcttctgatcactggaaccggcggcagcacccttagcagcacgataagcatcaggtgg |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43268210 |
ttacagagctaattccggctgcgaaaaaaggaataggcccgggcttctgatcactggaagcggcggcagcacccttagcagcacgataagcatcaggtgg |
43268111 |
T |
 |
| Q |
207 |
catttgaccatacacaacagaaacattaacaccagctttctcccaaacagcaccatcttgaagaactctactaatcccaccaccaccaccaggtcttgac |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43268110 |
catttgaccatacacaacagaaacattaacaccagctttctcccaaacagcaccatcttgaagaactctactaatcccaccaccaccaccaggtcttgac |
43268011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University