View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_low_50 (Length: 299)
Name: NF16240_low_50
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 13 - 284
Target Start/End: Complemental strand, 5750926 - 5750655
Alignment:
| Q |
13 |
tcatcatggagattttgaagaaacaatggtaagaattgtaacatcaaatggaggcatcatggaactttattctcccataacggttgaatgcataaccaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750926 |
tcatcatggagattttgaagaaacaatggtaagaattgtaacatcaaatggaggcatcatggaactttattctcccataacggttgaatgcataaccaac |
5750827 |
T |
 |
| Q |
113 |
gagtttccacaccatggaattttcaaaaacaaccgtaacacactctctaaaccactctcgaaaaacgaagaacttcaagctggtgaaatttactaccttc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750826 |
gagtttccacaccatggaattttcaaaaacaaccgtaacacactctctaaaccactctcaaaaaacgaagaacttcaagctggtgaaatttactaccttc |
5750727 |
T |
 |
| Q |
213 |
tccctctcaaaaatattgtcaaacaatttggtgaaacattcgaaacgttaactccgtatcgaatgtccacat |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750726 |
tccctctcaaaaatattgtcaaacaatttggtgaaacattcgaaacgttaactccgtatcgaatgtccacat |
5750655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University