View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_low_54 (Length: 284)
Name: NF16240_low_54
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 47949746 - 47949971
Alignment:
| Q |
1 |
atcctagggcttgttgagtattatggactatgattcatgacggttatttggttgcagcaattaaattggtttaggtatattatggactatgacaaccact |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47949746 |
atcctagggcttgttgagtattatgaactatgattcatgacggttatttggttgcagcaattaaattggtttaggtatattatggactatgacaaccact |
47949845 |
T |
 |
| Q |
101 |
aatagttatcattttaaggtatattatgtataggcttatgtcttattgtgtgagtattagaggatccaagtctgtcaccccagcgtaattttagtcgtta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47949846 |
aatagttatcattttaaggtatattatgtataggcttatgtcttattgtgtgagtattagaggatccaagtctgtcaccccagcgtaattttagtcgttt |
47949945 |
T |
 |
| Q |
201 |
tttaaaaattaaatctgaactgttga |
226 |
Q |
| |
|
|||||||||||||||||| ||||||| |
|
|
| T |
47949946 |
tttaaaaattaaatctgagctgttga |
47949971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University