View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_low_55 (Length: 275)
Name: NF16240_low_55
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 272
Target Start/End: Complemental strand, 17107087 - 17106824
Alignment:
| Q |
15 |
agctaaaacatcaaaattttcctggatgctaggatcattaaacaaatgttgcgcaagagtagttttacccataccccccatagcaacgagggaaattaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107087 |
agctaaaacatcaaaattttcctggatgctaggatcattaaacaaatgttgcgcaagagtagttttacccataccccccatagcaacgagggaaattaca |
17106988 |
T |
 |
| Q |
115 |
gagagcttatcatttttaaattttagccaatcagaaataagttctttctcattatccctgccataaataaaaggctcacgaggtagattagttgggatga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17106987 |
gagagcttatcatttttaaattttagccaatcagaaataagttctttctcattatccctgccataaataaaaggctcacgaggtagattagttggaatga |
17106888 |
T |
 |
| Q |
215 |
tccgtg------gagttaaaccaacagcagcagtgttatcattcaatgaaagggtattcttcat |
272 |
Q |
| |
|
|| ||| |||| ||||| |||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
17106887 |
tcggtgagcagagagtagaaccatcagcagcagttttatcattcaacgaaagggtattcttcat |
17106824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University