View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_low_63 (Length: 251)
Name: NF16240_low_63
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_low_63 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 3190563 - 3190314
Alignment:
| Q |
1 |
ttttttgttaagaaaaaatttaaatcaaataaagttaggtactttgtattgaaatctannnnnnnna--------agcttttggttttctgatttgagag |
92 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
3190563 |
ttttttgttaagaaataatttaaatcaaataaagttaggtactttgtattgaagtctattttttaaatttttttaagcttttggttttctgatttgagag |
3190464 |
T |
|
| Q |
93 |
gacaagttttgatgtaatctgtttgttttctgggaaaatcagtgaagcaaatttttttgaagttgctgtgaaaagtttaa-nnnnnnnnaatattttaat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3190463 |
gacaagttttgatgtaatctgtttgttttctgggaaaatcagtgaagcaaatttttttgaagttgctgtgaaaagtttaatttttttttaatattttaat |
3190364 |
T |
|
| Q |
192 |
ttctgaaaattgttgcaaaagtaaatgggagcttgaagtttttgcctttg |
241 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
3190363 |
ttctgaaaattgttgcaaaagttaatgggagcttgaagattttgcctttg |
3190314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University