View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_low_68 (Length: 246)
Name: NF16240_low_68
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 228
Target Start/End: Original strand, 26545153 - 26545370
Alignment:
| Q |
11 |
gagtgagatgaatgttgtactactaactaggtggttttattggcttgtgagccagagccttcacgagagtgatgggaaaaggaaaaatcttatggttttg |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26545153 |
gagtgagttgaatgttgtactactaactaggtggttttattggcttgtgagccagagccttcacgagagtgatgggaaaaggaaaaatcttatggttttg |
26545252 |
T |
 |
| Q |
111 |
gtatatcaatttccaaaaactataaccaagacaagaatataaaatgatgtaataatgtggatttgatactatagtctataatatcatttctcacggtcca |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26545253 |
gtatatcaatttccaaaaactatagccaagacaagaatataaaatgatgtaataatgtggatttgatactatagtctataatatcatttctcacggtcca |
26545352 |
T |
 |
| Q |
211 |
tgtttctaggttcctctt |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
26545353 |
tgtttctaggttcctctt |
26545370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University