View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_low_71 (Length: 238)
Name: NF16240_low_71
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_low_71 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 36962138 - 36962349
Alignment:
| Q |
1 |
cgattttaacttgttaatgtctagaaattagttggaatgatatgatcaggaatttaacttgttaatgtcttattgttttctcaaaatttctattctatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
36962138 |
cgattttaacttgttaatgtctagaaattagttggaatgatatgatcaggaatttaacttgttaatgtcttattgttttctgaaaatttctattcaatat |
36962237 |
T |
 |
| Q |
101 |
gtattatttttatcggtaaactttattaataaaccaccaaaccggtcatttagaaattacaaacaaagacgtcatatatagacagaacacccacaataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |||||| || ||||||| |||||||||| |
|
|
| T |
36962238 |
gtattatttttatcggtaaactttattagtaaacc-----------gatttagaaattacaaacaaagaccccatataaaggcagaacatccacaataaa |
36962326 |
T |
 |
| Q |
201 |
cacttcttaattatgacctatct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36962327 |
cacttcttaattatgacctatct |
36962349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 23 - 70
Target Start/End: Original strand, 36962112 - 36962159
Alignment:
| Q |
23 |
agaaattagttggaatgatatgatcaggaatttaacttgttaatgtct |
70 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
36962112 |
agaaattagttggaatgatatgatcacgattttaacttgttaatgtct |
36962159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University