View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_low_78 (Length: 225)
Name: NF16240_low_78
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_low_78 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 32810578 - 32810746
Alignment:
| Q |
1 |
tgtagaacaagaacatacacggagaatagctatagcggcagtttaatcagcagaggtatgccatctctaaccagtaactactgaccaattttgattgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32810578 |
tgtagaacaagaacatacacggagaatagctatagcggcagtttaatcagcagaggtatgccatctctaaccagtaactactgaccaattttgattgcat |
32810677 |
T |
|
| Q |
101 |
acacgcaatatttcccccactttcagaacaatggaactnnnnnnntaggtcagttttgatttcttattc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
32810678 |
acacgcaatatttcccccactttcagaacaatggaactaaaaaaataggtcagttttgatttattattc |
32810746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University