View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16240_low_82 (Length: 224)
Name: NF16240_low_82
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16240_low_82 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 224
Target Start/End: Complemental strand, 14700707 - 14700499
Alignment:
| Q |
16 |
aaattaactcaggcgtgtgtgattttgctctttatgtactagtggtggaagtttcccggaggttttatgtgagtgtgtggtggccagatggttttgaaga |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
14700707 |
aaattaactcaggcgtgtgtatttttgctctttatgtgctagtggtggaagttttccggaggttttatatgagtgtgtggtggccagacggttttgaaga |
14700608 |
T |
 |
| Q |
116 |
tggttttcatagataattggggagagaatcaacttgtttcaattttttattacgtgtcttgtttttgttggttgtgactatagatgacctcttagataac |
215 |
Q |
| |
|
|| |||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
14700607 |
tgcttttcatagataataggagagagaatcaacttgtttcaattttttattacttgtcttgtttttgttggttgtcactaaagatgacctcttagataag |
14700508 |
T |
 |
| Q |
216 |
agaccaagc |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
14700507 |
agaccaagc |
14700499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 16 - 221
Target Start/End: Complemental strand, 14694294 - 14694089
Alignment:
| Q |
16 |
aaattaactcaggcgtgtgtgattttgctctttatgtactagtggtggaagtttcccggaggttttatgtgagtgtgtggtggccagatggttttgaaga |
115 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||||||| | ||||||||| |||||||| ||||||| ||||| ||||||||||||||| ||||||||||| |
|
|
| T |
14694294 |
aaattaactcaggcatgtgtgttttttctctttatgtgcaagtggtggatgtttcccgaaggttttctgtga-tgtgtggtggccagacggttttgaaga |
14694196 |
T |
 |
| Q |
116 |
tggttttcatagataattggggagagaatcaacttgttt-caattttttattacgtgtcttgtttttgttggttgtgactatagatgacctcttagataa |
214 |
Q |
| |
|
|| |||||||||||||| || |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14694195 |
tgattttcatagataataggagagagaatcaacttgttttcaatttttgattacgtgtcttgtttttgttggttgtgactaaagatgacctcttagataa |
14694096 |
T |
 |
| Q |
215 |
cagacca |
221 |
Q |
| |
|
|||||| |
|
|
| T |
14694095 |
gagacca |
14694089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University