View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16241_high_8 (Length: 256)
Name: NF16241_high_8
Description: NF16241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16241_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 16 - 140
Target Start/End: Complemental strand, 44048098 - 44047974
Alignment:
| Q |
16 |
gaatatctgggtacaaatccagcctttttcccaatcccaaagctttatgagcatatcatcagatgacgacagaacataaggaagggtgggatgaactgcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44048098 |
gaatatctgggtacaaatccagcctttttcccaatcccaaagctttatgagcatatcatcagatgacgacagaacataaggaagggtgggatgaactgcc |
44047999 |
T |
 |
| Q |
116 |
acacatctaatgtaatctgtatgtg |
140 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44047998 |
acacatctaatgtaatctgtatgtg |
44047974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 136 - 241
Target Start/End: Original strand, 44047993 - 44048098
Alignment:
| Q |
136 |
atgtgtggcagttcatcccacccttccttatgttctgtcgtcatctgatgatatgctcataaagctttgggattgggaaaaaggctggatttgtacccag |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44047993 |
atgtgtggcagttcatcccacccttccttatgttctgtcgtcatctgatgatatgctcataaagctttgggattgggaaaaaggctggatttgtacccag |
44048092 |
T |
 |
| Q |
236 |
atattc |
241 |
Q |
| |
|
|||||| |
|
|
| T |
44048093 |
atattc |
44048098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 17 - 134
Target Start/End: Original strand, 3142559 - 3142676
Alignment:
| Q |
17 |
aatatctgggtacaaatccagcctttttcccaatcccaaagctttatgagcatatcatcagatgacgacagaacataaggaagggtgggatgaactgcca |
116 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||| || ||||| ||||||||||||||||| |||| |
|
|
| T |
3142559 |
aatatctgggtacagatccagcctttttcccaatcccaaagctttatgagcatatcatccgacgacgatagcacatagggaagggtgggatgaacagcca |
3142658 |
T |
 |
| Q |
117 |
cacatctaatgtaatctg |
134 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
3142659 |
cacacctaatgtaatctg |
3142676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 137 - 240
Target Start/End: Complemental strand, 3142662 - 3142559
Alignment:
| Q |
137 |
tgtgtggcagttcatcccacccttccttatgttctgtcgtcatctgatgatatgctcataaagctttgggattgggaaaaaggctggatttgtacccaga |
236 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| || ||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3142662 |
tgtgtggctgttcatcccacccttccctatgtgctatcgtcgtcggatgatatgctcataaagctttgggattgggaaaaaggctggatctgtacccaga |
3142563 |
T |
 |
| Q |
237 |
tatt |
240 |
Q |
| |
|
|||| |
|
|
| T |
3142562 |
tatt |
3142559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University