View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16241_low_14 (Length: 248)
Name: NF16241_low_14
Description: NF16241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16241_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 52 - 239
Target Start/End: Complemental strand, 812546 - 812361
Alignment:
| Q |
52 |
gagattagactgttaagattacacatcagttttagtgaagctgtatgatctcagccgttaaaccaaatcggacagttgagagtagtaaatgtgccacaca |
151 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
812546 |
gagattagactgttaagattacacatcaattttagtgaagctgtatgatctcagccgttaaaccaaatcggacagttgagagaagtaaatgtgccacaca |
812447 |
T |
 |
| Q |
152 |
agttaatgcaccaactccaaattcattgcggattctcttagtttgtgatataaactaatatttcatttcattttatattcatctcact |
239 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
812446 |
agttaatgcaccaactccaaattcattgtggattctcttagtttgtgaaataaa--actatttcatttcattttatattcatttcact |
812361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University