View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16242_low_1 (Length: 449)
Name: NF16242_low_1
Description: NF16242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16242_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 1e-60; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 309 - 431
Target Start/End: Original strand, 4255109 - 4255231
Alignment:
| Q |
309 |
caacttgaaattgcttcaacttttgttgttagaaaattcaaaactacaagatggcagaatctgcagtatggtttgtcttgagacaagtataccaacttct |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4255109 |
caacttgaaattgcttcaacttttgttgttagaaaattcaaaactacaagatggcagaaactgcagtatggtttgtcttgagacaagtataccaacttct |
4255208 |
T |
|
| Q |
409 |
aaaagatgaaacaagattactaa |
431 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4255209 |
aaaagatgaaacaagattactaa |
4255231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 9 - 87
Target Start/End: Original strand, 4254824 - 4254902
Alignment:
| Q |
9 |
gattatactagatgaataaataaggtgttcagagtttgaagattaacccttacatattagaatacattgtctctgccaa |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||| |||||| |
|
|
| T |
4254824 |
gattatactagatgaataaataaggtgttcagagtttaaaaatcaacccttacatattagaatacattgtctgtgccaa |
4254902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 115 - 163
Target Start/End: Original strand, 4254928 - 4254976
Alignment:
| Q |
115 |
atctatgaattatttttcatttccgaatgattttctaacgtgtaagctc |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4254928 |
atctatgaattatttttcatttccgaatgattttctaacgtgtaagctc |
4254976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University