View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16243_high_10 (Length: 232)
Name: NF16243_high_10
Description: NF16243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16243_high_10 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 128 - 224
Target Start/End: Original strand, 38472556 - 38472651
Alignment:
| Q |
128 |
caggttcagagagagagaacaaatcttgaactgattttgactcaattgttgactccaccaatgacttctttcaatttcgatttagtcagtataatct |
224 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38472556 |
caggttcagagagagaga-caaatcttgaactgattttgactcaattgttgactccaccaatgacttctttcaatttcgatttagtcagtacaatct |
38472651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 17 - 95
Target Start/End: Original strand, 38472418 - 38472495
Alignment:
| Q |
17 |
atcataaccagccccatctctccctctctctaaaactatcccttcatcttgcatacacgagattcaattgacacaacta |
95 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38472418 |
atcataaccagccccatctc-ccctctctctaaaactatcccttcatcttgcatacacgagattcaattgacacaacta |
38472495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 128 - 223
Target Start/End: Original strand, 46017910 - 46018005
Alignment:
| Q |
128 |
caggttcagagagagagaacaaatcttgaactgattttgactcaattgttgactccaccaatgacttctttcaatttcgatttagtcagtataatc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||| ||| |||| |
|
|
| T |
46017910 |
caggttcagagagagagaacaaatcttgaactgattttgactcaattgttgactccatcaatgacttcttccaattccgatttagtccgtacaatc |
46018005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 73
Target Start/End: Original strand, 47496 - 47553
Alignment:
| Q |
17 |
atcataaccagccccatctctccctctctctaaaact-atcccttcatcttgcataca |
73 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
47496 |
atcataaccacccccatctctccctatctctaaaactcattccttcatcttgcataca |
47553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 73
Target Start/End: Complemental strand, 27439866 - 27439809
Alignment:
| Q |
17 |
atcataaccagccccatctctccctctctctaaaact-atcccttcatcttgcataca |
73 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
27439866 |
atcataaccacccccatctctccctatctctaaaactcattccttcatcttgcataca |
27439809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University