View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16243_low_8 (Length: 251)
Name: NF16243_low_8
Description: NF16243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16243_low_8 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 44799624 - 44799856
Alignment:
| Q |
13 |
atgaaccgaaaacaagcagataaaagtgtttatgtttttgttgttgttgttgaccgaacagtgtttctgtttatttctcctctatcctttactactttgt |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44799624 |
atgaacctaaaacaagcagataaaagtgtttatgtttttgttgttgttg---accgaacagtgtttctgtttatttctcctctat---ttactactttgt |
44799717 |
T |
|
| Q |
113 |
ttcgcaatttggttgtaaagccaatcatttatgtttacaaagattaatgtaactacacctcgatgatcttttgtccttttggatacctccataacttgcc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44799718 |
ttcgcaatttggttgtaaagccaatcatttatgtttacaaagattaatgtagctacacctcgatgatcttttgtccttttggatacctccataacttgcc |
44799817 |
T |
|
| Q |
213 |
aattgccatcacccaccctttgaacctctagaaaacatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44799818 |
aattgccatcacccaccctttgaacctctagaaaacatt |
44799856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 215 - 251
Target Start/End: Original strand, 44803641 - 44803677
Alignment:
| Q |
215 |
ttgccatcacccaccctttgaacctctagaaaacatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44803641 |
ttgccatcacccaccctttgaacctctagaaaacatt |
44803677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University