View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16244_high_23 (Length: 269)
Name: NF16244_high_23
Description: NF16244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16244_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 94 - 254
Target Start/End: Original strand, 33403056 - 33403215
Alignment:
| Q |
94 |
cttgaccttaattagattgttcctctatctctttcactatatttacattctttacatctgtctatgtgaaaaggaaatttggtgacagcttttaatgtca |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33403056 |
cttgaccttaattagattgttcctctatctctttcactatatttacattctttacatctgtctatgtgaaaaggaaatttggtgacagcttttaatgtca |
33403155 |
T |
 |
| Q |
194 |
aagcactaa---gcaacacattttggctgtcacatttatttataagttggttttgagaataatc |
254 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33403156 |
aagcactaattcgcaacacattttggctgtcac----atttataagttggttttgagaataatc |
33403215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 33402963 - 33402992
Alignment:
| Q |
1 |
agacaaagcaattatagaataatcaacgtg |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33402963 |
agacaaagcaattatagaataatcaacgtg |
33402992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University