View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16244_high_24 (Length: 267)
Name: NF16244_high_24
Description: NF16244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16244_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 145 - 259
Target Start/End: Original strand, 53461088 - 53461202
Alignment:
| Q |
145 |
ttattgtgaatgtttagtatgattgttgctcattctttggctgtcactctctcgtatgttggatatttttctcttgccttcttgttgtctatagttcctc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53461088 |
ttattgtgaatgtttagtatgattgttgctcattctttggctgtcactctctcgtatgttggttatttttctcttgccttcttgttgtctatagttcctc |
53461187 |
T |
 |
| Q |
245 |
tctcatattcttctc |
259 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
53461188 |
tctcctattcttctc |
53461202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 23 - 111
Target Start/End: Original strand, 53460949 - 53461037
Alignment:
| Q |
23 |
gtcattgctccttatttggttgttctctcatcttctcgtggttggttgatcatctcttaattatagtgtgtggcttaatatggtcgttg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
53460949 |
gtcattgctccttatttggttgttctctcatcttctcgtggttggttgatcatctctttattatagtgtgttgcttaatatggtcgttg |
53461037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University