View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16244_high_7 (Length: 461)
Name: NF16244_high_7
Description: NF16244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16244_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 187 - 443
Target Start/End: Complemental strand, 27791900 - 27791646
Alignment:
| Q |
187 |
catcctcaatttttggatctaaatcgggcttatgtgctgaatgcatgaatgcagcaaatttgtgactgcagcgaatctgatgtgtaattaacaatgtgtg |
286 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27791900 |
catcctcaatttttggatctagatcaggcttatgtgctgaatgcatgaatgtggcaaatttgtgactgcagcgaatctgatgtgtaattaacaatgtgtg |
27791801 |
T |
|
| Q |
287 |
tggggttctaaaacaagtttggtttcttttaggtgagttgccacatttcaggtgctgattctgcacttgtccaactgatcatgtcaaaagctttttcatg |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27791800 |
--gggttctaaaacaagtttggtttcttttaggtgagttgccacatttcaggtgctgattctgcacttgtccaactgatcatgtcaaaagctttttcatg |
27791703 |
T |
|
| Q |
387 |
ctttggatttgcacgttttttgctggtcctgtgccgtagctaagctttgaagtttgt |
443 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27791702 |
ctttggatttgcacgttttttgctggtcctgtgccgtagctaagctttgaagtttgt |
27791646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 27792031 - 27791876
Alignment:
| Q |
1 |
ggatgtactaactaatttagccttgctttcacatctagtggaactcttctgtcacagatgtaaagcttaactttactgtcatgcccaggattccctgcag |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27792031 |
ggatgtactaactaatttatccttgctttcacatctagtggaactcttctgccccagatgtaaagcttaactttactgtcatgcccaggattccctgcag |
27791932 |
T |
|
| Q |
101 |
tcacaaatttgccgcattcatgcatatggcacatcctcaatttttggatctagatc |
156 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27791931 |
tcacaaatttgccgtattcatgcatatggcacatcctcaatttttggatctagatc |
27791876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 89 - 125
Target Start/End: Original strand, 27791824 - 27791860
Alignment:
| Q |
89 |
gattccctgcagtcacaaatttgccgcattcatgcat |
125 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
27791824 |
gattcgctgcagtcacaaatttgccacattcatgcat |
27791860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University