View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16244_low_17 (Length: 369)
Name: NF16244_low_17
Description: NF16244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16244_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 132 - 331
Target Start/End: Original strand, 9422449 - 9422644
Alignment:
| Q |
132 |
agacagccatcagtaaagaacgagatatggaatcaaatccaaaaaatctatgtaaccacccttgctgttctgatgtttgaatagtttgatctgtgaagga |
231 |
Q |
| |
|
|||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9422449 |
agacagccattagaaaagaacgagatatggcatcaaatccaaaaaatctatgtaaccacccttgctgttctgatgtttgaatagtttgatctgtgaagga |
9422548 |
T |
|
| Q |
232 |
tttcaaagtcttctgatcggtgtggatatataataaactattacaccatcagtggtaaccagactagcctaaaaacgcacgccagtgccagtgtttgatg |
331 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9422549 |
tttcaaagtcttctgatcggtgtgg----ataataaacaattacaccacctgtggtaaccagagtagcctaaaaacgcacgccagtgccagtgtttgatg |
9422644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 10 - 105
Target Start/End: Original strand, 9421736 - 9421824
Alignment:
| Q |
10 |
aagaattataagccatgaagttgtcatcacatgccttatatgtgaagtattatttattattccagaattcgacccacgagagtaatctggaccaag |
105 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9421736 |
aagaattgtaagccatgaagatgtcatcacatgccttatatatgaag-------tattataccagaattcgacccacgagagtaatcttgaccaag |
9421824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University