View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16244_low_18 (Length: 346)
Name: NF16244_low_18
Description: NF16244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16244_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 52 - 341
Target Start/End: Original strand, 17661407 - 17661692
Alignment:
| Q |
52 |
ctccccatccttatttggataacgctctacttgcagatacatcctcaattgaactcatcccccgatttcattaaaatgtcgagcaagtgttgcattcatt |
151 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17661407 |
ctccccatccttattttgataacgc----cttgcagatacatccttaattgaactcatcccccggtttcattaaaatgtcgagcaagtgttgcattcatt |
17661502 |
T |
 |
| Q |
152 |
tcattttcagcgataaatttgcaactaattcaatgataacaatgcgttnnnnnnncaaggctccatggtcaaccaaggctcctctctcacctcaaaacct |
251 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17661503 |
tcattttcaacgttaaatttgcaactaattcaatgataacaatgcgttaaaaaaacaagcctccatggtcaaccaaggctcctctctcacctcaaaacct |
17661602 |
T |
 |
| Q |
252 |
cgagaaatgcattgttatttattgcctgtagcacaaatctttattgttgtaagtggttcgtactgtacgtatatgtcttgttggcctttg |
341 |
Q |
| |
|
| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
17661603 |
tgggaaatgcattgttatttattgtctgtagcacaaatctttattgttgtaagtggttcgtattggacgtatatgtcttgttggcctttg |
17661692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 254 - 341
Target Start/End: Original strand, 17697704 - 17697791
Alignment:
| Q |
254 |
agaaatgcattgttatttattgcctgtagcacaaatctttattgttgtaagtggttcgtactgtacgtatatgtcttgttggcctttg |
341 |
Q |
| |
|
||||||||||| |||||||||| |||||||| || ||||||||||||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
17697704 |
agaaatgcatttttatttattgtctgtagcaaaactctttattgttgtaagtggtttgtactgaacttatatgtcttgttggcctttg |
17697791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 17661349 - 17661406
Alignment:
| Q |
19 |
actaacatgtcgactccttgaagttgtggatttctccccatccttatttggataacgc |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17661349 |
actaacatgtcgactccttgaagttgtggatttctccccatccttattttgataacgc |
17661406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University