View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16244_low_23 (Length: 322)
Name: NF16244_low_23
Description: NF16244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16244_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 82 - 309
Target Start/End: Complemental strand, 40848005 - 40847777
Alignment:
| Q |
82 |
cttgatatttagggaatgtagtatgcatgtgattcctctaagacctttttatgcatgcaattttgtagcacaaatttctctc-ttttggagatatgaatg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
40848005 |
cttgatatttagggaatgtagtatgcatgtgattcctctaagacctttttatgcatgcaattttgtagcacaaatttctctccttttggagacatgaatg |
40847906 |
T |
 |
| Q |
181 |
ggtgaaacatggcacgtgttccacttttaaaatgttggactattttacgatttccctaaatatcaaggatagggtatatattctaaatgccaaatcatgt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40847905 |
ggtgaaacatggcacgtgttccacttttaaaatgttggactattttacgatttccctaaatatcaacgatagggtatatattctaaatgccaaatcatgt |
40847806 |
T |
 |
| Q |
281 |
acgacgtcaagggtggcaagacacaggtt |
309 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
40847805 |
acgacgtcaagggtggcaagacaccggtt |
40847777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University