View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16244_low_33 (Length: 245)
Name: NF16244_low_33
Description: NF16244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16244_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 152 - 228
Target Start/End: Original strand, 48207845 - 48207921
Alignment:
| Q |
152 |
aagagcttgtagagttattctacattccatcatttgctatttttaacaactcaaccttattttgagttattcaatat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48207845 |
aagagcttgtagagttattctacattccatcatttgctatttttaacaactcaaccttattttgagttattcaatat |
48207921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 41
Target Start/End: Original strand, 48206069 - 48206105
Alignment:
| Q |
5 |
gtctttaacgtcattttctttattttctaaatatcat |
41 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
48206069 |
gtctttaacgtcattttctttattttttaattatcat |
48206105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University