View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16244_low_35 (Length: 238)
Name: NF16244_low_35
Description: NF16244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16244_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 15 - 218
Target Start/End: Original strand, 33651798 - 33652002
Alignment:
| Q |
15 |
agcagagacattcatatttaccaaattatttcttaactatagtggatgatcatgcaaaactcattctgccaatgcaagtttgtgagaactattaaaattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33651798 |
agcagagacattcatatttaccaaattatttcttaactatagtggatgattatgcaaaactcattctgccaatgcaagtttgtgagaactattaaaattt |
33651897 |
T |
 |
| Q |
115 |
aatttgataataatg-nnnnnnnnaaaaataaaaatatgtaatgtaatgcaagtgtcttctcacatggttttctgatatatgtaggacatgctatagaat |
213 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33651898 |
aatttgataataatgtttttttttaaaaataaaaatatgtaatgtaatgcaagtgtcttctcacatggttttctgatatatgtaggacatgctatagaat |
33651997 |
T |
 |
| Q |
214 |
gaact |
218 |
Q |
| |
|
||||| |
|
|
| T |
33651998 |
gaact |
33652002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University