View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16244_low_37 (Length: 224)
Name: NF16244_low_37
Description: NF16244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16244_low_37 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 1451864 - 1452087
Alignment:
| Q |
1 |
ttgacagttatgtcctccatgccatggaatcttacattgtgcgcagaataatttgtgacaagatggaaactcggcattggtcacaattttaatctcatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1451864 |
ttgacagttatgtcctccatgccatggaatcttacattgtgcgcagaataatttgtgacaagatggaaactcagcattggtcacaattttaatctcatcg |
1451963 |
T |
 |
| Q |
101 |
ttcaacaacgaaactgaacaattcttgaatggacagttcccccatatatatttatgacccgataagagaatttctgtcttctttttcttttcttcaacat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
1451964 |
ttcaacaacgaaactgaacaattcttgaatggacagttcccccatatatatttatcacccgataggagaatttctgtcttctttttcttttctgcaacat |
1452063 |
T |
 |
| Q |
201 |
catgcaatgaaaacaagtcttcca |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1452064 |
catgcaatgaaaacaagtcttcca |
1452087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University