View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16244_low_38 (Length: 217)
Name: NF16244_low_38
Description: NF16244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16244_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 48890434 - 48890255
Alignment:
| Q |
17 |
ttattctgaaattaaatcccaaacacgaacgcaactatcttctcccgaactgaccactctttctggctcaataaaagtcaagccatacactccacctaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48890434 |
ttattctgaaattaaatcccaaacacgaacgcaactatcttctcccgaactgaccactctttctggctcaataaaagtcaagccatacactccacctaaa |
48890335 |
T |
|
| Q |
117 |
tgagccccttttatggttctgcggcttgatgctggctttccaatttcgtatacaataacacatgtatcaagtgaaccagt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48890334 |
tgagccccttttatggttctgcggcttgatgctggctttccaatttcgtatacaataacacatgtatcaagtgaaccagt |
48890255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University