View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16245_low_5 (Length: 206)
Name: NF16245_low_5
Description: NF16245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16245_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 12 - 191
Target Start/End: Original strand, 28305765 - 28305944
Alignment:
| Q |
12 |
caaaggaaaaacttaaaggatcgcaggtgcaactttgcctaattcttaggtagttaaaattaggctgtgtaaagttacaagacaatgtgataagatatag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28305765 |
caaaggaaaaacttaaaggatcgcaggtgcaactttgcctaattcttaggtagttaaaattaggctgtgtaaagttacaagacaatgtgataagatatag |
28305864 |
T |
 |
| Q |
112 |
gactaatggactataccttgtctaggtctttaattgaacctttccctctaatatatacgcggcaacctgtggtagcctct |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28305865 |
gactaatggactataccttgtctaggtctttaattgaacctttccctctaatatatacgcggcaacctgtggtagcctct |
28305944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 124 - 190
Target Start/End: Original strand, 32220708 - 32220774
Alignment:
| Q |
124 |
ataccttgtctaggtctttaattgaacctttccctctaatatatacgcggcaacctgtggtagcctc |
190 |
Q |
| |
|
||||||| || | |||||| ||||||||||||||||| ||| ||||||||||||| || |||||||| |
|
|
| T |
32220708 |
ataccttatcaaagtcttttattgaacctttccctctgataaatacgcggcaaccagtagtagcctc |
32220774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University