View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16247_low_2 (Length: 326)
Name: NF16247_low_2
Description: NF16247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16247_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 8 - 309
Target Start/End: Complemental strand, 38581467 - 38581166
Alignment:
| Q |
8 |
ctcaacagctcaagcataaaagtggtgtttcttggccccaaaggaaacttaacactttatttgaacttgggatagagaatgaaattgtgtcctcattcaa |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38581467 |
ctcaacagctcaagtataaaagtggtgtttcttggccccaaaggaaacttaacactttatttgaacttgggatagagaatgaaattgtgtcctcattcaa |
38581368 |
T |
 |
| Q |
108 |
gttagttttatttactgctcattgtgaaatgtaccttatatctctgaaaaaactctgcatctctgatgagtctgaggatggagtctatagtcagtaaacc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
38581367 |
gttagttttatttactgctcattgtgaaatgtaccttatatctctgaaaagactctgcatctctgatgagtcagaggatggagtctgtagtcagtaaacc |
38581268 |
T |
 |
| Q |
208 |
acacaatgtatgatcatgaatctcttaaactgctgtataaatatctcaggctctctaccatactcttccaatggcgtatgtgtcagtcaccaagcttcaa |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38581267 |
acacaatgtatgatcatgaatctcttaaactgctgtataaatatctcaggctctctaccatactcttccaatggcgtatgtgtcagtcaccaagcttcaa |
38581168 |
T |
 |
| Q |
308 |
ag |
309 |
Q |
| |
|
|| |
|
|
| T |
38581167 |
ag |
38581166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University