View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16248_high_11 (Length: 256)
Name: NF16248_high_11
Description: NF16248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16248_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 97 - 235
Target Start/End: Original strand, 39918352 - 39918490
Alignment:
| Q |
97 |
ttccaatcatgtccctgttttcacaaaactagcctacgttttaggcttaagagtttctccaaatcatagaagaatgggaatagggctaaaactggtagag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918352 |
ttccaatcatgtccctgttttcacaaaactagcctacgttttaggcttaagagtttctccaaatcatagaagaatgggaatagggctaaaactggtagag |
39918451 |
T |
|
| Q |
197 |
aaaatggaacaatggtttcgtgaaaatggtgctgagtat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918452 |
aaaatggaacaatggtttcgtgaaaatggtgctgagtat |
39918490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 39918256 - 39918303
Alignment:
| Q |
1 |
tgagacagtcggaatgatacgaggttgtatcaaaaccgttacatgcgg |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918256 |
tgagacagtcggaatgatacgaggttgtatcaaaaccgttacatgcgg |
39918303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University