View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16248_high_12 (Length: 250)
Name: NF16248_high_12
Description: NF16248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16248_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 27672639 - 27672875
Alignment:
| Q |
1 |
aaaagtcaatggctcgccgtaattctgtcaaacgtcacaatgatatcaaacatgcacatagaagtcatgaaatttacctgagcttttagttttaactaca |
100 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27672639 |
aaaagtcaatggctcaccgtaattttgtcaaacgtcacaatgatatcaaacatgcacatagaagtcatgaaatttacctgagcttttagttttaactaca |
27672738 |
T |
|
| Q |
101 |
tgaacagcaataacacaatcaccaggttcagcaactttaacaatagcccaattgagaagctgtctgctatggctatctattctaatcccaaccaacacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27672739 |
tgaacagcaataacacaatcaccaggttcagcaactttaacaatagcccaattgagaagctgtctgctatggctatctattctaatcccaaccaacacaa |
27672838 |
T |
|
| Q |
201 |
acctcttttcaactgtcattgtgttatgttctgccct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27672839 |
acctcttttcaactgtcattgtgttatgttctgccct |
27672875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 220
Target Start/End: Original strand, 55179794 - 55179910
Alignment:
| Q |
107 |
gcaataacacaatcaccaggttcagcaactttaacaatagcccaattgagaagctgtctgct---atggctatctattctaatcccaaccaacacaaacc |
203 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||| | |||||||| ||||| ||||||||||| ||| ||||| |||||||| || ||||| ||| | | |
|
|
| T |
55179794 |
gcaataacataatcacgaggttgagcaactttggctatagcccagttgaggagctgtctgctgccatgcctatcaattctaattcccaccaaaacacatc |
55179893 |
T |
|
| Q |
204 |
tcttttcaactgtcatt |
220 |
Q |
| |
|
||| || ||||||||| |
|
|
| T |
55179894 |
tctctttcactgtcatt |
55179910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University