View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16248_high_20 (Length: 205)
Name: NF16248_high_20
Description: NF16248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16248_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 2 - 190
Target Start/End: Complemental strand, 27672605 - 27672417
Alignment:
| Q |
2 |
acctactatgaattgctttctccttgtgtattgtaaattttgtgcttcgtagtagtgaaataagttacttcaatgcagattatgtttctaaaaacaagag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27672605 |
acctactatgaattgctttctccttgtgtattgtaaattttgtacttggtagtagtgaaataagttacttcaatgcagattatgtttctaaaaacaagag |
27672506 |
T |
|
| Q |
102 |
cctaatagatggatatttagaggtttatgaaggcttgtgtgatgtgaaaaaggtaaaccnnnnnnnnccaccttatttttgttttcttt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27672505 |
cctaatagatggatatttagaggtttatgaaggcttgtgtgatgtgaaaaaggtaaaccttttttttccaccttatttttgttttcttt |
27672417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University