View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16248_low_8 (Length: 288)
Name: NF16248_low_8
Description: NF16248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16248_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 272
Target Start/End: Complemental strand, 32320195 - 32319934
Alignment:
| Q |
12 |
acagatcaagtcgtaataacaaaatggctaattaacttacgcaaatgcatgaaattcaattgttgcattgtgaatgtgacaaatact-aggtaacttgca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32320195 |
acagatcaagtcgtaataacaaaatggctaattaacttacgcaaatgcatgaaattcaattgttgcattgtgaatgtgacaaatactaaggtaacttgca |
32320096 |
T |
 |
| Q |
111 |
attaagcaaaacggccaaacgacagcttgtcnnnnnnnnacgtgagcagattaaaatattatatgctttaagaaaacaaataaaaaggcaattgtgcagt |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32320095 |
attaagcaaaacggcaaaacgacagcttgtcttttttttacgtgagcagattaaaatattatatgctttaagaaaacaaataaaaaggcaattgtgcagt |
32319996 |
T |
 |
| Q |
211 |
ttccttttaataaggaccgcatttaaggatcattgaatttaacttagttgataggaacaata |
272 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
32319995 |
ttccttttaataaggaccgcatttaagggtcattgaatttaacttagttgatagggacaata |
32319934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University