View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16249_low_19 (Length: 225)
Name: NF16249_low_19
Description: NF16249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16249_low_19 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 12 - 225
Target Start/End: Original strand, 22683090 - 22683302
Alignment:
| Q |
12 |
aaagggaaacatttgctagtgcgatagaaggcttctgctactgatattcattttcatcaaagaaacattacaagcaaatgctcattctcacaattcacaa |
111 |
Q |
| |
|
||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22683090 |
aaagggaaacatttgctagtggtatggaaggcttatgctactgatattcattttcatcaaagaaacattacaagcaaatgctcattctcacaattcacaa |
22683189 |
T |
 |
| Q |
112 |
gcacataattataatccttctctcatgactacagatcaagatagctttttcaaaccacataaagcatacaacaaacaattttgtcttacaagtccaaaaa |
211 |
Q |
| |
|
||| |||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
22683190 |
gcatataattataatccttctctcatgattacagatcaagatagcttgttcaaaccacataaagcata-aacaaacaattttgtcttacaagtctaaaaa |
22683288 |
T |
 |
| Q |
212 |
tatccaacacaagc |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
22683289 |
tatccaacacaagc |
22683302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University