View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1624_high_37 (Length: 268)
Name: NF1624_high_37
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1624_high_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 32936299 - 32936558
Alignment:
| Q |
1 |
gtaaatgaaattctaagtataaatatagaatagttaaatatgataagtattgcagataatatgttttaaaattgaggaacaaaaagaatcaatttgtgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32936299 |
gtaaatgaaattctaagtataaatatagaatagttaaatatgataagtattgcagataatatgtgttaaaattgaggaacaaaaagaatcaatttgtgtt |
32936398 |
T |
 |
| Q |
101 |
taaatgnnnnnnngaaggaagtaaatggaggatttgaaactcaccgaggaggaaagaagtacgggaattatttttagtttttagattgtggttgttgagg |
200 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32936399 |
taaatgaaaaaaagaaggaagaaaatggaggatttgaaactcaccgagaaggaaagaagtacgggaattatttttagtttttagattgtggttgttgagg |
32936498 |
T |
 |
| Q |
201 |
acaaatgtattttgtggttgtgaatgatgatgatgatagtgagttctttttatgatgatg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32936499 |
acaaatgtattttgtggttgtgaatgatgatgatgatagtgagttctttttatgatgatg |
32936558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University