View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1624_high_41 (Length: 249)
Name: NF1624_high_41
Description: NF1624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1624_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 60 - 229
Target Start/End: Original strand, 40878800 - 40878974
Alignment:
| Q |
60 |
agagaaggtagattggaccgggtggttagaccggtt-----tggggaaatggataccaaatgagttgaaccgaaccgagtatagtctttagtaccggtag |
154 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40878800 |
agagatggtagattggaccgggtggttagaccggtttggtttggggaaatggataccaaatgagttgaaccgaaccgagtattgtctttagtaccggtag |
40878899 |
T |
 |
| Q |
155 |
ttgtgacttgtgagcgatgtgttactaacttagggtcaagaaggacatttacttaaactaacttttaaattatat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40878900 |
ttgtgacttgtgagcgatgtgttactaacttagggtcaagaaggacatttacttaaactaacttttaaattatat |
40878974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 40878712 - 40878776
Alignment:
| Q |
1 |
agttgaagccattgtcggagggaaatctcactgattcacgcaacgtatcagtttcattgagagaa |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40878712 |
agttgaagccattgtcggagggaaatctcactgattcacgcaacgtatcagtttcattgagagaa |
40878776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University